Cameron Roots @_croots
I've nuked my twitter. FInd me on Bluesky @croots.me or Mastodon @[email protected] Austin, TX Joined April 2018-
Tweets49
-
Followers62
-
Following93
-
Likes438
LAYearn @YearnLa41677
58 Followers 4K Following
Cuivow @Cuivow2065879
37 Followers 2K Following
Oleta Altenwerth @OAltenwert66901
25 Followers 2K Following
Kaylin Reinger @kaylin9300
81 Followers 4K Following
Erika Alden DeBenedic... @erika_alden_d
4K Followers 2K Following CEO of @Pioneer__Labs, founder of @Align_Bio, resident @AsteraInstitute Former astronomer 🌎 recovering computer scientist 🤖 current molecular biologist 🧬🧪
Forever° @Forever1819051
39 Followers 4K Following
AndreaGaskell @d2I2wsZy7svYv
68 Followers 7K Following
Opentrons @opentrons
6K Followers 661 Following Open-source liquid handling robots for scientists https://t.co/orXJPHYhh6
Susan @susan_sneed35
223 Followers 3K Following
Quenby @Smeti162367
16 Followers 2K Following Getting better slowly is the best gift you can give yourself.
Daniel Correa @CorreaDan
2K Followers 2K Following CEO of @scientistsorg. BoD @IFP and @MetroLabNetwork. Alum of @WHOSTP44 and @ITIFdc. Making jokes with @rebeccaleefunk.
Katrina Rogers @TweetKatrinaR
210 Followers 665 Following The world needs your big idea! I guide underrepresented life science founders and investors who want to make a difference. #KatrinaRogers
Federation of America... @scientistsorg
27K Followers 514 Following Striving for a safer world since 1945.
Cara Rozgonyi @Cara_Rozgonyi
21 Followers 42 Following
Camilo Gómez-Garzón @camilog137
269 Followers 634 Following Postdoc at @fredhutch Colombian 🇨🇴 Team Bacteria 🦠 (He/Él) 🏳️🌈
James Dodd @James_Dodd_
179 Followers 231 Following PhD student at the University of Edinburgh in @kdunnresearch. Developing electrosynbionic devices using DNA nanotechnology and cyanobacteria. He/Him
Neftalí Vázquez @vazquezn14
191 Followers 209 Following Cell and Molecular Biology PhD Candidate. UT Austin- Wallingford lab
نايف @nyf13307162
3 Followers 58 Following
naturepoker @naturepoker1
1K Followers 1K Following Amateur biologist at Binomica Labs. Phage hunting. #amateurbiology @[email protected] https://t.co/dvUy3KczVN https://t.co/zAFupGZgMp
Manuel M @mm03993418
248 Followers 149 Following gatgaagcgcgccgcgaagcggatgaacgcccgctggaagcgagcgaaagcgcgtatcatatt
Texas Region Biotech ... @TXBionetworks
379 Followers 3K Following #LifeScience #news, #jobs and #events from the #Texas region, including #Dallas #Austin #Houston. Part of @BiotechNetworks, connecting #biotech since 2008.
LB Agar 🏎️ 🦠 @shasta_bio
64 Followers 277 Following Accelerating the progress of talented biologists is my jam🌻
Jude Tunyi @JTunyi
286 Followers 393 Following Current G1 MD-PhD Student @OhioStateMSTP and @NIHOxCam. Fulbright Finland Scholar. Thoughts and views are my own. Cogito ergo sum.
Oscar Ruiz @intheOR
828 Followers 2K Following
Creation Myths @theevilutionist
735 Followers 108 Following Evo biologist gleefully debunking creationist nonsense. “Troubler of the creation world” - YEC Dr. Rob Carter, CMI. he/him. https://t.co/KGQ79w8kYj
plasmidsaurus @plasmidsaurus
11K Followers 10K Following Pioneers in the sequencing of whole plasmids, amplicons, whole bacterial genomes & more. 900+ dropboxes and 10 labs globally.
Aditya Kunjapur @kunjapur
3K Followers 3K Following Thomas Willing Early Career Assoc. Prof. @UDelaware | Otto Mønsted Visiting Prof, DTU Fall '25 | Newer-to-nature building blocks #synbio https://t.co/4VVWd3IuKj
Julie Perreau, PhD @jmaperreau
702 Followers 542 Following Genomics Scientist @brukercellular | Microbiology PhD | #DiversityInSTEM | she/her
Elizabeth C Robinson @EBCRobinson
12 Followers 44 Following Biology + Humanities major @ UT Austin Lover of creative writing + dad jokes Hater of gatekeeping + writing Twitter bios Aspiring synthetic biologist + writer
Letti Lopez @lettilopez
411 Followers 955 Following Microbiology PhD | Into phages and other tiny things | “I’m not a mad scientist, I’m just a disappointed scientist.”
The Perplex Group @ThePerplexGroup
2K Followers 2K Following A Global Media Company which offers entertainment, comedy & education. Managed by @ThePerplexTeam We follow back (usually)
Synbio Powerhouse Fin... @SynbioFi
1K Followers 2K Following #SynBio Ecosystem - Groundbreaking science meets industry disruption. We build connections between researchers, businesses & investors. Powered by @VTTFinland
David Taylor @davidwtaylorjr
1K Followers 415 Following Associate Professor / photographer of macromolecular assemblies / uncle / single dog dad / views are my own
Jessica Chen 🐈�... @jessicawtchen
195 Followers 319 Following PhD @virologyharvard, @nsf GRFP, @NIH F31, @fujifilmUS fellow, @mortarboard fellow |Ex @nih postbac, @uhmanoa ‘18 | 🦠👩🏻🔬 | 🐈⬛ | 3 am 💭
Amanda Bohanon @BohanonAmanda
23 Followers 50 Following Graduate Student at the University of Texas at Austin
Christy @christy_cas9
38 Followers 88 Following
Rachael Cox @rachaelmcox
150 Followers 455 Following Biochemistry PhD candidate working in @edward_marcotte's lab @utaustin. Comparative multi-omics & evolution. 👩🔬💻
Matt McGuffie @matt_mcguffie
225 Followers 588 Following https://t.co/d09SLq4G8K Bioinformatics Lead at plasmidsaurus bacteriology, phages, plasmids, synthetic biology Not active here: https://t.co/AV6fh9uLDD
UT iGEM Team @UT_iGEM
363 Followers 274 Following University of Texas at Austin Synthetic Biology Team
Tdlane.bsky.social �... @AJLane54
220 Followers 183 Following He/Him, Jewish, Geology student, professional gigamoron. Nazism is a plague and manifest destiny is too. Transit oriented development goes BRR. ❤ @cyber_torrent
@dakotaraptor.bsky.so... @DDakotaraptor
25 Followers 139 Following I Nerd, Game, and sometimes interact with Science minded friends
NaturalSciences @ UT @TexasScience
11K Followers 2K Following Official account for the College of Natural Sciences at The University of Texas at Austin. #TexasScience @UTAustin
Jeffrey Barrick @barricklab
2K Followers 394 Following We use evolution experiments to understand the genetics of adaptation and engineer microbial evolvability. #synbioevolves #breseq
Anastasiya Kulikova @kulikova_av
13 Followers 47 Following
Henry Pan @Henry_S_Pan
115 Followers 791 Following Postdoctoral Researcher at @UCSF in the DeGrado, Condello, and Southworth labs studying Amyloid Diseases with 🦠 Protein Design, 🔬Cryo-EM, and💡Fluorescence
Austin Graham 🧪�... @austinjgraham
307 Followers 537 Following Postdoctoral Fellow with @ZevGartner at @UCSF & @CZBiohub. #LivingMaterials Science 🧬🦠, live music 🎶, and brews ☕️🍺. UCSB ‘16 🌊, UT ‘21 🤘. he/him 🏳️🌈
Christopher Dundas @C_M_Dundas
1K Followers 3K Following scientist, engineer, music & coffee lover ☕️ (he/him) | assistant professor @uga_plantbio & @uga_iob
Woolston Lab @WoolstonLabNEU
199 Followers 194 Following Synthetic Biology & Metabolic Engineering in renewable biotechnology and the HGM The official Twitter account of Woolston Lab @northeastern Est. 2020
Pentagon Pizza Report @PenPizzaReport
237K Followers 73 Following Pentagon Pizza Report: Open-source tracking of pizza spot activity around the Pentagon (and other places). Frequent-ish updates on where the lines are long.
Synthetic Biology Aus... @SynBioAusAsia
3K Followers 556 Following Official voice of Synthetic Biology Australasia | Connecting #SynBio in Australasia since 2014 | https://t.co/Qgai97NI9B
ARC Centre of Excelle... @ARC_CoESB
2K Followers 710 Following The ARC Centre of Excellence in Synthetic Biology (CoESB) is developing a vibrant bioeconomy based on Australia's strengths. Also on https://t.co/hCrAqi2hXF
bioRxiv Synthetic Bio... @bioRxiv_synbio
2K Followers 1 Following
hasanabi @hasanthehun
1.6M Followers 2K Following i stream everyday on https://t.co/8ITEAnynTB - tiktok+ig: hasandpiker // business: mailto:[email protected]
Tom Ellis @ProfTomEllis
25K Followers 587 Following Synthetic Biology & Synthetic Genomics @ Imperial College London and the Sanger Institute. Bilingual in English and DNA. D-/L-
Union of Concerned Sc... @UCSUSA
66K Followers 5K Following The Union of Concerned Scientists puts rigorous, independent science to work to solve our planet's most pressing problems. 🦋BlueSky: @ucs.org
Federation of America... @scientistsorg
27K Followers 514 Following Striving for a safer world since 1945.
ZBiotics @ZBioticsCompany
2K Followers 50 Following Maker of the world's first genetically engineered probiotics. Purpose-built to help our bodies handle the diets and environments of modern life.
ACS Synthetic Bio @ACSSynBio
11K Followers 319 Following This account is no longer active or monitored. For updates about ACS Synthetic Biology, follow @ACSBioMed and @ACSPublications.
Science Policy Jobs @SciPolJobs
4K Followers 18 Following Jobs, fellowships & internships in science policy. From @ESEPCoalition, managed by @PublicHeath & @GwendolynBogard w/ lots of help from friends. #SciPolJobs
MasterScreen @MasterScreenApp
231 Followers 53 Following The ultimate set of tools for running tabletop or online roleplay campaigns and managing intricate fictional worlds. Runs on any device without any downloads.
Oliver @DrToddOliver
747 Followers 818 Following Environmental scientist engulfed in science policy around emerging tech. Tweets are my own. #genomics #synbio #citizenscience #diybio
Camilo Gómez-Garzón @camilog137
269 Followers 634 Following Postdoc at @fredhutch Colombian 🇨🇴 Team Bacteria 🦠 (He/Él) 🏳️🌈
1usmus 🇺🇦 @1usmus
20K Followers 96 Following OC & low-level dev. Making silicon sing. Author of HYDRA, CTR, DRAM calculator for Ryzen. Hardware reviewer, photographer, bodybuilder. Early access here \/
Tim Stearns @StearnsLab
16K Followers 1K Following Professor and Dean at The Rockefeller University. Cell biologist. Believer in the power of science education.
Neftalí Vázquez @vazquezn14
191 Followers 209 Following Cell and Molecular Biology PhD Candidate. UT Austin- Wallingford lab
Manuel M @mm03993418
248 Followers 149 Following gatgaagcgcgccgcgaagcggatgaacgcccgctggaagcgagcgaaagcgcgtatcatatt
Rep. Alexandria Ocasi... @RepAOC
746K Followers 603 Following This account is maintained by federal staff to share services and legislation relevant to constituents of NY-14.
Leonid Kruglyak @leonidkruglyak
16K Followers 1K Following Geneticist. Professor @UCLA. @Strava addict. Occasional mountaineer. Analyzing large datasets since long before #BigData became cool. My tweets are my own.
Jude Tunyi @JTunyi
286 Followers 393 Following Current G1 MD-PhD Student @OhioStateMSTP and @NIHOxCam. Fulbright Finland Scholar. Thoughts and views are my own. Cogito ergo sum.
Eric Klavins @klavins
1K Followers 1K Following Professor and Chair of UW ECE. Trying to save the world through synthetic biology, electrical and computer engineering, truth, and beauty.
AirProtein @AirProtein
788 Followers 12 Following Air Protein is an revolutionary climate tech company.
Josie Zayner @josiezayner
20K Followers 1K Following Mad pirate queen at @webuildlife & @theodininc - PhD Biophysics from @Uchicago -Frmr @NASA Scientist - Read my story-letter https://t.co/b6lb87ApUu
The ODIN @TheODINInc
6K Followers 2K Following Hands-on all-in-one Genetic Engineering Kits for all. No experience required. Check out our CRISPR kit and others at https://t.co/LURRfIN2Sh
ben grosser @bengrosser
4K Followers 2K Following Artist focused on software culture. Creator of Demetricator, Endless Doomscroller, ORDER OF MAGNITUDE, https://t.co/Gtt8S0xY3T. Faculty assoc @BKCHarvard, Prof UIUC
Michael Hammerling @mjhammerling
282 Followers 180 Following Synthetic Biology, genomics, directed/experimental evolution, and engineering of molecular translation. Advancing AI for Biology at Future House, SF
Ben Jack 🏳️�... @benrjack
454 Followers 501 Following Find me on Bluesky @benjaminjack.bsky.app. Data things at Kenvue. Views are my own. he/him #python #rstats
plasmidsaurus @plasmidsaurus
11K Followers 10K Following Pioneers in the sequencing of whole plasmids, amplicons, whole bacterial genomes & more. 900+ dropboxes and 10 labs globally.
Light Bio @light_bio
7K Followers 22 Following We are creating bioluminescent plants for home and garden. Our plants glow with perpetual organic light, giving a magical experience of amazement and delight.
Jason McLellan @McLellan_Lab
11K Followers 223 Following Professor of Molecular Biosciences The University of Texas at Austin Opinions are my own and not the views of my employer
Elizabeth C Robinson @EBCRobinson
12 Followers 44 Following Biology + Humanities major @ UT Austin Lover of creative writing + dad jokes Hater of gatekeeping + writing Twitter bios Aspiring synthetic biologist + writer
Dan Stern Cardinale @DSternCardinale
365 Followers 197 Following Biology professor, political junkie, YIMBY, nerd. Unions ftw.
Julie Perreau, PhD @jmaperreau
702 Followers 542 Following Genomics Scientist @brukercellular | Microbiology PhD | #DiversityInSTEM | she/her
Howard Salis @hsalis
4K Followers 261 Following Assoc Professor of synthetic biology, biological, & chemical engineering. De Novo DNA founder. Engineering microbes with predictive models & algorithms.
microPublication @Micropub7n
2K Followers 173 Following Publishing brief and citable scientific observations.
SynBio Canada @SynBioCanada
2K Followers 728 Following Join the 🇨🇦 #synbio community at https://t.co/DxaLDqHJqX Student and Postdoc-led advocacy and outreach. Become a member for free https://t.co/fHQVd3h26u
Spencer J. Fox @FoxandtheFlu
1K Followers 610 Following Assistant Professor in Epi/Biostats/Bioinformatics at UGA. Epidemiologist, biologist, and data scientist. These are my personal thoughts and opinions.
BEACON Center @BEACON_Center
1K Followers 846 Following An NSF Science and Technology Center for the Study of Evolution in Action
Creation Myths @theevilutionist
735 Followers 108 Following Evo biologist gleefully debunking creationist nonsense. “Troubler of the creation world” - YEC Dr. Rob Carter, CMI. he/him. https://t.co/KGQ79w8kYj
Tabor Lab @LabTabor
2K Followers 374 Following We are a synthetic biology research group in the Bioengineering Department at Rice University.
Letti Lopez @lettilopez
411 Followers 955 Following Microbiology PhD | Into phages and other tiny things | “I’m not a mad scientist, I’m just a disappointed scientist.”
Molecular Biosciences @ut_mbs
685 Followers 60 Following We study molecular, microbial, cellular, developmental, chemical, plant, structural, systems & synthetic biology @TexasScience @UTAustin.
David Taylor @davidwtaylorjr
1K Followers 415 Following Associate Professor / photographer of macromolecular assemblies / uncle / single dog dad / views are my own
Jessica Chen 🐈�... @jessicawtchen
195 Followers 319 Following PhD @virologyharvard, @nsf GRFP, @NIH F31, @fujifilmUS fellow, @mortarboard fellow |Ex @nih postbac, @uhmanoa ‘18 | 🦠👩🏻🔬 | 🐈⬛ | 3 am 💭
Rachael Cox @rachaelmcox
150 Followers 455 Following Biochemistry PhD candidate working in @edward_marcotte's lab @utaustin. Comparative multi-omics & evolution. 👩🔬💻Trends for United States
41,6 B posts
5.779 posts
70,8 B posts
27,3 B posts
20,3 B posts
1,17 Mn posts
4.646 posts
19 B posts
3.148 posts
19 B posts
9.790 posts
8.570 posts
11,2 B posts
2.872 posts
52,2 B posts
20,3 B posts
10,6 B posts
5.287 posts
You might like
Camilo Gómez-Garzón
@camilog137
269 Followers
Mia Konjikusic, PhD
@KonjikusicMia
373 Followers
Jimmy Gollihar
@DrJimmyDale
499 Followers